El País in English11h
Mexico records largest fentanyl seizure in history
The Secretariat of the Navy seized 1,500 kilos of opioid pills in the Mexican state of Sinaloa amid the ongoing cartel war ...
El País in English8h
AI to slash music and audiovisual industry revenues by over 20% by 2028, report warns
The first major study on the economic impact of new technology on the arts warns of the likely ‘cannibalization’ of catalogs ...
El País in English16h
Who is Yoon Suk Yeol, the leader behind the political crisis that has shaken South Korea?
After a three-decade career as a prosecutor, the president made the leap into politics in 2021 with a halo of fighting ...
El País in English9h
The 24 DNA letters linked to autism: GCAAGGACATATGGGCGAAGGAGA
A team of Spanish scientists has discovered the mechanism that could explain a high percentage of autism spectrum disorders ...
El País in English12h
Gender treatment of trans minors lands in the US Supreme Court
The justices are considering the case of the parents of a teenager who sued the State of Tennessee for prohibiting her access ...
El País in English9h
The new king midas of television is a cowboy who lives on a ranch
Taylor Sheridan is behind the success of ‘Yellowstone’ and the creator of series such as ‘Tulsa King,’ ‘Mayor of Kingstown’ ...
El País in English10h
Brian Thompson, UnitedHealthcare CEO, shot dead in New York
The executive was preparing to participate in a conference with investors at a Manhattan hotel when he was killed. The ...
El País in English14h
Migrant caravans continue despite Trump’s threats
A fifth group of about 1,500 people from Venezuela, Colombia, Haiti, and Central America left Chiapas as tensions and ...
El País in English14h
Bhopal: Dark tourism at the scene of the worst industrial disaster in history
Victims’ advocacy organizations continue to demand fair compensation and criticize the tourist use of the factory 40 years ...
El País in English10h
Texas raises alarm over rising number of unaccompanied children at the border
Videos of agents intercepting two little girls in the state have gone viral, as over 100 minors traveling alone are caught ...
El País in English16h
South Korean opposition files motion to impeach president after martial law debacle
The opposition has demanded the resignation of President Yoon Suk Yeol after the political storm caused by his announcement ...
El País in English8h
The United States raises reward for El Mencho to $15 million
The White House has set a price on the capture of the leader of the Jalisco New Generation Cartel, offering more than the reward for Los Chapitos and the same amount it would pay for Nicolás Maduro ...